Support It

  • Subscribe to our RSS feed.
  • Twitter
  • StumbleUpon
  • Reddit
  • Facebook
  • Digg

Tuesday, 20 December 2011

Evolution - The Meaning of Information

Posted on 13:36 by Unknown
Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).



Where do they get these ideas from?



Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.



I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.



If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...



Of course, there is no reason at all why this should be impossible; a proposition which is rendered even more absurd by the observable fact that it happens. There should be a clue here for Creationists. Hint: impossible things don't happen; things that happen are not impossible. (I appreciate the logic there might need more than a few moments thought for the average Creationist.)



So, what would this mutation do? In case you didn't notice, the second group of three letters has changed from UAU to UCU. In terms of the genetic code, this will mean the resulting protein will have the amino acid serine in place of tyrosine. The answer of course depends on what the protein does. If it's an enzyme, the chances are that, unless this section is from the functional part of the enzyme, it will have little or no effect at all.



So what new information has arisen by this mutation? Unless you regard changed information as new information, there is no new information. The information still tells a cell how to build the enzyme.



But what might have changed is the meaning of the information, and, just as with written language, the meaning of the information written down depends entirely on the environmental context. Written language only has meaning in the context of an environment in which literate speakers of the language exist. Otherwise, it has no more meaning than random marks on paper.



I'll illustrate this with a hypothetical, but possible, scenario:



In recent history, humans learned to harvest the natural sap of the rubber tree and use it as a material. A little latter, we learned to process this latex chemically by a process called vulcanisation which makes a much stronger substance suitable for making things like car tyres. Now millions of tons of vulcanized rubber are deposited annually on our roads and washed off into waterways or blown as dust into surrounding countryside to be incorporated into the soil.



Now, rubber is a natural substance, even in it's vulcanized form, so in theory is should be possible for a bacterium or a fungus to evolve the ability to process all this rubber in the environment. Maybe if only for the sake of road safety, we are fortunate that none has yet done so, so far as we know.



But, what if a mutation like the one I mentioned above were to change an enzyme in such a way that made this possible? What if this small change in information, in the context of all this man-made vulcanized rubber, gave a bacterium or a fungus a new source of energy?



What an advantage that would give it compared to forms carrying the non-mutated gene!



But what if this mutation had arisen, say, 500 years ago? It would, of course, have been completely meaningless and would have conveyed no advantage whatsoever. A mutation only has meaning in the context of the environment in which it arises. Out of that context it has no meaning at all.



It is the meaning of the information which changes and that depends on the environment. Environmental change drives evolution by giving meaning to the information in the genetic code. New meaning arises because new environments arise.



Share on Twitter.

Tweet


Email ThisBlogThis!Share to XShare to FacebookShare to Pinterest
Posted in Creationism, Evidence | No comments
Newer Post Older Post Home

0 comments:

Post a Comment

Subscribe to: Post Comments (Atom)

Popular Posts

  • Evolution Of A Plague of Locusts
    Magicicada adults and final stage nymphs. Photograph by Arthur D. Guilani If it hasn't happened already, and you live in the Eastern US...
  • Favourite Oxymorons - Religious Logic
    One of the more absurd arguments for religion (in this case Christianity) I've seen today is: "If God doesn't exist then there...
  • The Power Of The Story
    Once upon a time, in a continent not far away, there dwelt a puny ape who had learnt to walk upright so it could see further than other men ...
  • Christians - Try Not To Think About Matthew.
    What was it with Matthew, or whoever it was writing the stuff attributed to him in the Bible? Later on in the Bible, Matthew seems to presen...
  • Why Did The Believer Cross The Road?
    Faith: The sure and certain way to know that ever other faith is wrong. Faith is just not a sensible way to live your life. If you tried to...
  • A New Angle On Sex For Creationists
    The extent to which some males will go for sex is amazing, and this has nothing at all to do with dangly things - only females have these an...
  • What is Reddit FOR Exactly?
    Normally, I confine this blog to articles dealing with all aspects of religion, science as it relates to the claims of religion, and occasio...
  • Christianity Is No Excuse - ECHR
    European Court of Human Rights refuses to hear appeals in three ‘Christian persecution’ cases » British Humanist Association : Congratulatio...
  • Religion Kills - Mormon Massacre
    The Mountain Meadow Massacre To illustrate how readily and easily religions turn their followers into killers in the name of their gods, her...
  • Saint Valentine
    St Valentine Kneeling In Supplication David Teniers III (1638-1685) Saint Valentine is one of many similar legendary saints of the Christian...

Categories

  • Agnosticism
  • Anthropology
  • Apologetics
  • Art
  • Astronomy
  • Atheism
  • Bible
  • Bible Contradictions
  • Biology
  • Birds
  • Catholics
  • Christianity
  • Christmas
  • Conservation
  • Cosmology
  • Cosmos
  • Creationism
  • Crime
  • Cults
  • Culture
  • Delusion
  • Democracy
  • Dogma
  • Evidence
  • Evolution
  • Faith
  • Fallacy
  • Feminism
  • Fraud
  • Freedom
  • Genealogy
  • Genocide
  • Geology
  • Gullibility
  • Health
  • Hindu
  • History
  • Hormones
  • Human Rights
  • Humanism
  • Humour
  • Hypocrisy
  • Intelligence
  • Islam
  • Judaism
  • Language
  • Learning
  • Logic
  • Memes
  • Mental Health
  • Miracles
  • Morality
  • Mormon
  • Music
  • Mythology
  • Nature
  • Oxfam
  • Parasitism
  • Peace
  • Physics
  • Physiology
  • Politics
  • Pope
  • Probability
  • Progress
  • Psychology
  • Qur'an
  • Racism
  • Religion
  • Religious abuse
  • Science
  • Secularism
  • Superstition
  • Theology
  • Vatican
  • Vegetarianism
  • Wildlife
  • Yule

Blog Archive

  • ►  2013 (201)
    • ►  October (22)
    • ►  September (26)
    • ►  August (12)
    • ►  July (16)
    • ►  June (24)
    • ►  May (24)
    • ►  April (16)
    • ►  March (20)
    • ►  February (15)
    • ►  January (26)
  • ►  2012 (269)
    • ►  December (17)
    • ►  November (20)
    • ►  October (22)
    • ►  September (14)
    • ►  August (21)
    • ►  July (23)
    • ►  June (23)
    • ►  May (16)
    • ►  April (41)
    • ►  March (37)
    • ►  February (18)
    • ►  January (17)
  • ▼  2011 (30)
    • ▼  December (19)
      • What A Pain: Does God Hate Everything?
      • Jesus - History or Hoax?
      • The Depths To Which Christians Will Go...
      • Are The Bible's Publishers Breaking The Law?
      • Foolish Jesus And The Ravening Wolves
      • Talking Turkey
      • Evolution - The Meaning of Information
      • If God Wants Us To Believe In Him
      • Oops! Another Bible Blunder
      • Ten Commandments - Tory Version
      • Impressions of Prague - Jan Palach and Jan Zajíc
      • A Favourite Fallacious Fallacy
      • Theists for Genocide
      • Talking Bible Babble
      • You'd Never Believe The Things Some People Believe
      • Permitting Extremists
      • God The Liar Almighty
      • Unintelligent Design - Forming Alliances
      • Cats Vs Dogs
    • ►  November (11)
Powered by Blogger.

About Me

Unknown
View my complete profile